Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0043
Clone ID AY0043
Vector pGT0lxr
Project sanger

Sequence tag AY0043
Sequence
ACAGAGTCGCACATGGATTGGGAAAAAGTTGCGTTTAAGGATTTTTCAGGAGATATGTGCAAGCTCAAATGGGTGGAGAT
TTCTAACGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTCGATGCTCAGGAACATGTTAAAAACCCTTACAAAG
GCAAAAAGCTCAAGAAACACCCGGATTTTCCAAAGAAACCTCTCACCCCTTACTTCCGCTTCTTCATGGAGAAGCGGGCC
AAGTACGCGAAGCTCCACCCGGAGATGAGCAACCTGGACCTGACTAAGATCCTGTCTAAGAAATACAAGGAACTTCCAGA
GAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGG
ATCACCCTGACCTTATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAACCCAAAACTCCCCAGCAACTGTGGTACACC
CACGAGAAGAAGGTGTATCTCAAAGTGCGGCCGGAT
Sequence Type mRNA
Unitrap ID UNI3062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102172694..102176267 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es