Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11617F9
Clone ID IST11617F9
Vector VICTR76
Project tigm

Sequence tag IST11617F9HMF1
Sequence
ACCNCAGCCCGGCTAGGATATGTTTATCTCAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62644931..62644973 41
NO GENE  


Sequence tag IST11617F9HMR1
Sequence
TGGTGACACACATCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACA
GAGTGAGTTCCAGGACAGCCAAGGCTATACAGAGAAACTCTGTCTCAAAAACAAACAAACAAACAAACAAACAAACAAGA
GATAAATATATCCTGGTCACAATCTATTATCTTTTTGATATGTTTCTGGATCCGGTTTATTGGCATTTGGTTTANAACTT
TTGCATTTTTTGTTCAAGTACAAAATCAACTTCNNTTTTCCCTCTCCTACTTCTGTCACANANGANTTGCCCCAAACCCC
AAGGGTGATGCTTAANCCNTGCCANGGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62644584..62644934 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es