Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14790E12
Clone ID IST14790E12
Vector VICTR76
Project tigm

Sequence tag IST14790E12HMF1
Sequence
ACATTAACCTTTTCTGCATTTTCAGAAGTTTACCTTTTTATTTTTTACCTTCAGAAGTTTCAAATTCTTGACATTGGGCA
CTTCATTTCTTTCTTAAATAGCTGAGAGCACTGGACATCACTTAGTGTTCAGGACTACAAATTCTTTCCTCTATACATTG
CTGACTCTCTTTTCCTCTACTGAACCCATGCGCCAGATGACCTCCACTAACCCTGTATACCTCCATGGGAACTGCACTAA
CATTCAAGATTCATAAAATTGCAGTCACTGCNACTATTTCTCTTTNNNNNNTNNNNANTNNTTCNTCCNTTCNAGTGAAA
TTTACTATNNNNNNNNTANATTTTGAAGAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14790E12BBF1
Sequence
ACATTAACCTTTTCTGCATTTTCAGAAGTTTACCTTTTTATTTTTTACCTTCAGAAGTTTCAAATTCTTGACATTGGGCA
CTTCATTTCTTTCTTAAATAGCTGAGAGCACTGGACATCACTTAGTGTTCAGGACTACAAATTCTTTCCTCTATACATTG
CTGACTCTCTTTTCCTCTACTGAACCCATGCGCCAGATGACCTCCACTAACCCTGTATACCTCCATGGGAACTGCACTAA
CATTCAAGATTCATAAAATTGCAGTCACTGCTACTATTTCTCTTTTAAAATTCTTTATTCTTTCATCCTTTCAAGTGAAA
TTTACAATCATCTCATTATATTTTGAAGANAAAAACATTNTGTANGACTGGGGAGGTAGATCAGCAGANAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117111445..117541447 384
NO GENE  


Sequence tag IST14790E12HMR1
Sequence
ATGTTTNNATACTTNNAAGGAAAAAAAATGATTTATTTATATTATGTGAGTATACTGTCACTCTTCAGACACACCAGAAG
AGGGCATCAGATCCCTTTACATACAGATGGTTGTGACCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAG
AACAGTCAGTGCTCTTAACCGTTGAGCCATCTCTCTGTTCAGGTTAATTTAATACACATATAAACCCATAGAAATTGATG
GAGAAAAACCCACAGACTAANACNGANTCC
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117541444..117541712 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es