Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168E2
Clone ID IST14168E2
Vector VICTR74
Project tigm

Sequence tag IST14168E2HMF1
Sequence
GGGCGAAGCCAACATGTGGTTCGGGGCTACCTTGAACCCCTGACTCAAGGTATTCTTCTGCCTCAATCTTCTGTGAAGCT
GGAATTTGAGAAATACGAGTCACTGCCTGCTTAGTACCTCAGCTCCTTTTTGCTAGTGTTTTTTTGTTTTGTATTTATGA
CTTTTAATTATCATTAAAGACTGAGTAGTTTAAAAATGACAATAATTCAGTAAGTCATTTTGAGTTAATAAAAAGCCATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18375518..18375756 239
NO GENE  


Sequence tag IST14168E2HMR1
Sequence
NNGCCCANAATGTGTCCATCACTCCTGAGAGCTTCCTTATATCCCCACCTGCAGTGACCTTCTGCGACATTTTCCNNAAT
CTAATATGAATGAAATTACCCCATCTGAACCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26736094..26736207 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]


Sequence tag IST14168E2BBF1
Sequence
GGGCGAAGCCNACATGTGGTTCGGGGCTACCTTGAACCCCTGACTCAAGGTATTCTTCTGCCTCAATCTTCTGTGAAGCT
GGAATTTGAGAAATACGAGTCACTGCCTGCTTAGTACCTCAGCTCCTTTTTGCTAGTGTTTTTTTGTTTTGTATTTATGA
CTTTTAATTATCATTAAAGACTGAGTAGTTTAAAAATGACAATAATTCAGTAAGTCATTTTGAGTTAATAAAAAGCCATC
AACTTAAGACTAATATTAAAAATATAAAATAGTGCTGAGTGGGGGTACAGCCTTTAATCCCAGACCTTGGGAGGCAGAGG
CCTACAGGACAGCCACAGCTACTCAAAAAAACCCTGTCTGGAACCACTCCCACTTCCAAACATACGTACATACATGCATG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18375323..18375756 430
NO GENE  

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es