Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13152B12
Clone ID IST13152B12
Vector VICTR74
Project tigm

Sequence tag IST13152B12BBF1
Sequence
ACTGCCCAAAACACGTGGAAGAGAAACCAACTCTCCACTAATGTTGCATATGAAAGCTCTATAGGCTCTAGATTATCTCA
CTTGACCATCACAGCAACCGTACGGCCTAATTTCATGAATGAGTACAACTCAGGATCTGGAGGTGAGACTTGCCCAAGGT
CACTCACTCCAGAAATCATTGAGGCTGCTATACCTAGAAGGTCGCACTTTATCTGANCCGTTCCACTACATCATCCCGCC
TCCCAACTGTGGTACTAGGACAGTACCAGANCGGGGATCGCACAGTGTAACCCACACTACCCCTGCCCTACCANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 117162533..117162851 313
NO GENE  


Sequence tag IST13152B12HMF1
Sequence
CTTAGATCACATTTTCTAACCGTTCCCTCCGCATTGAACTGTCCATAGTAGCATCATTTGCCCTTGTTCTGCATTATAAT
CAGACCTATTTCTGGGGTCAGGTGGGACAAATGACTGTAAAATCGGTGTGCTCANCATCTGAACTGCTCACTCTTTTTGC
TATTGCTAAGCGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI2993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79239281..79239456 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es