Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14940F4
Clone ID IST14940F4
Vector VICTR76
Project tigm

Sequence tag IST14940F4BBF1
Sequence
ACACGTATTTTTAAAAGGAGAAAGAGAAGGGGCTCTGCAGGCTAGGGAGTGCAGTTCACTGGTACAGGACACGCCTAGCA
TGCATGAAAGAAGCTATGGGTTCCATCTCCAACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGAC
AGCACAGTACAAGTAGGTAGAAATTCCACAGGCAAGGAGTTGAAAGGGCACCAGGAAGCCTGGGCCACCCAGCTGGACGG
ACTATCACAACCATCTCGACTGCCCGAGGACATCCTTCAACTGAGATAACTGAACCCCAGAGGGAGGTGTATGTCACANC
TGANTCNCTAGGCGTCNCNTANCCCAAGGCTCTGGGANACAANATTGCNNCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249356..17249728 353
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST14940F4HMF1
Sequence
ACACGTATTTTTAAAAGGAGAAAGAGAAGGGGCTCTGCAGGCTAGGGAGTGCAGTTCACTGGTACAGGACACGCCTAGCA
TGCATGAAAGAAGCTATGGGTTCCATCTCCAACACTATAAAACAAAAGGAAAGTAACTGCGAGGGAGGACAAGCAGAGAC
AGCACAGTACAAGTAGGTAGAAATTCNNCNGGCNANGAGTTGAAAGGGCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249518..17249728 201
NO GENE  


Sequence tag IST14940F4HMR1
Sequence
GTGTTTAACNNATGGTGGTGGTGGTGGTGACTTTAATCCAACTTTAATCCCAGCACTTGGGAATCAGAAGCAGGCGGATA
GGTCTCAGGGAGTTTGAGGCCAGCCTGGTTAAATGGTGTGTGTTTCCTGTACCTGTACAGAAGTGCACACACACAGTACC
TTTGTAAATGAGAGGACAGTTTCTGTANCANTCATTGTGCTGCCATGTGGGACCCACCTATTAAGCTCAGTTGGTCAAGC
GTGN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17249725..17249967 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es