Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15054E5
Clone ID IST15054E5
Vector VICTR80
Project tigm

Sequence tag IST15054E5HMR1
Sequence
AGGCAGGGGAAAGGTATTTGAATTTTGAACTATTCCAGGAAATATGACTTTAATAATATGCTTTCAGATCCTATAACCAG
AATAACCAGAACTCATGAAGAAGAACTAATCCTCTCTGCTCTTCACCTCTAAGCCATTCACAAAGTCTGCATCCTCGTTG
GAATGGATTCACATTCTTGTCTAATGAGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83385786..83385977 192
 
EST/CDNA Est Name
  AI426814.1


Sequence tag IST15054E5BBF1
Sequence
CTGGCTTGTACTTCTTTTTCGTTTTCAGATTGATTGGTTCAGTTAGGAGCACCAGGCGGGTTGTACCTAACAACAGAAGT
CAGACCTCCTATTTTTCAACTTTTAAAAAAAATATATGTGTAGACTCCAAAGTCCACACTCAAGAATGAGAGCTGAGAGA
CCCAGTCTGTTATAGGAAGTCATCTAAGAAGTAGACCAGGCAGGAATGGCTGTTTAAGCCTAGCAGAGGAGAGAAAGCAA
TTCCTCCTGTGTCCTAATGAATTCCCTTTTCATGTGGAAAGCTGGCTTTTGTTGTTGCTAATAATACAGGATTTCCTTCA
NAGAATTTTTAATGTCTTGTTCAGATACCACACANAGAGATATTGACCACNNATANTAATACTGGNNNGNNANATATGTT
GANGTGANGNTGTCCCNACCNTTANTANNCNGN
Sequence Type genomic DNA
Unitrap ID UNI451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83385343..83385769 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]

 
Come back to gene ENSMUSG00000031714


For any suggestions or comments, please send an email to unitrap@crg.es