Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15044A5
Clone ID IST15044A5
Vector VICTR78
Project tigm

Sequence tag IST15044A5HMF1
Sequence
GAGGAAACCCTGGCAGAGTACCTGAGGGGGAGTTGTTCTCTGGCATCATTTATAACTGTAGGTACTGGCAAGGCCGGAGT
CAGAGCATGTCC
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71187788..71187878 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST15044A5HMR1
Sequence
ATGGAGGAAGGAAGGTGAGGATTCCCAGANTGCAGGGGTCCCACACAGGATTCAAGAAGCACCAAGACAGAGCATCAGAA
TCCTGGCTATCCAGTGAGTCTCAGACCAAGGGCTTCGAGGAGCTTCCAGCCACAAAGGGCAAGACCTTTGGAAACGTGAG
CTCTGAAAAGATTGTGGGACCAGAGATGCTGATCCAGTCTAAAGGGCACGTAATCTGAAGGGTCCTGCTTTAAGGAAATC
AATANAAAACTACCAACTGCTAGGGATGTCAAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI33362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45838679..45838955 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035551 (Igfbpl1) NM_018741 insulin-like growth factor binding protein-like 1 Gene [Source:MGI (curated);Acc:Igfbpl1-001]


Sequence tag IST15044A5BBF1
Sequence
GAGGAAACCCTGGCAGAGTACCTGAGGGGGAGTTGTTCTCTGGCATCATTTATAACTGTAGGTACTGGCAAGGCCGGAGT
CAGAGCATGTCAACAAAACCATTTGTTTTCCTCCTTGGCTTCTGTGTCCTTGGTAGCTTGTGCTAATGCTGCTGTTTCCT
GGATTTTACAGTCAGAGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71187696..71187878 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es