Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14733B9
Clone ID IST14733B9
Vector VICTR76
Project tigm

Sequence tag IST14733B9HMF1
Sequence
CACACCTCACTCTGGTCCCAGGGAGCCTCAACGTGTCCACCATTCCCACAAGCCAGGATCCCAGTGGACTAAGACACAGC
TACATGAGTGTGGCCCAGTCCTGGAGTGACACCAGAGTCCCCAGACCCTGTTCACCTTTGGGTGGCTTGCCTATCATGGA
GAAACAGCCTGATCTACCCTCCTGCCTGAACCGGAGCCTGGAGGGCCTATGAGGGTTCAGAGCTGGCAGTGTGGGTTCAG
TCACTGATCCCCTGACCTAAAGGTGGTCACCGAAGCACAGGTATCTCAGGAATGTTCATTTCTACCGGGCTTCCTCCACA
TTCCTGCGCCCCGCCCATCTCCACCAAGAATTCCTCANANTAAACACACCAGGGAGCCTCTGANGGCACAGGGGCCCCAA
GCANGTCTGCTACACCTCCGTGTGGCGTGTGGTCAGCACTTGGCCCTACCAACACCGGTGTGGCACCTGGGGGTGTCCCA
TTCNCTCCCCACTTTGCCCATATACATNCCGGGANACTGAANAACAAAGANGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179954726..179955258 513
 
EST/CDNA Est Name
  AA073084.1 - BG246574.1 - BI078471.1 - CJ123991.1 - CJ105261.1 - CJ106094.1 - CJ124774.1


Sequence tag IST14733B9BBF1
Sequence
CACACCTCACTCTGGTCCCAGGGAGCCTCAACGTGTCCACCATTCCCACAAGCCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179954726..179954785 60
NO GENE  


Sequence tag IST14733B9HMR1
Sequence
TTGTGTAGATGAAGCTGGGCTGGGGCTGGTTGATCCTACACACGATTCTGCCAGTTCAGAGACTTGTGTCTCCATGCCTA
TACCACAACGCAGCTGGCCTCTGCTCCTTCCTGGACCTGTGTGCCTTCTGCCACCTGAGGTGGGAG
Sequence Type genomic DNA
Unitrap ID UNI35768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179954585..179954729 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015647 (Lama5) NM_001081171 laminin, alpha 5 Gene [Source:MGI (curated);Acc:Lama5-001]

 
Come back to gene ENSMUSG00000015647


For any suggestions or comments, please send an email to unitrap@crg.es