Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14583B1
Clone ID IST14583B1
Vector VICTR74
Project tigm

Sequence tag IST14583B1HMR1
Sequence
TGTGGTTCNGCTTCTGGAGGAGCAATCGCTCACGGATTGAAAAAGTTACTTCTCTCAGAGTAAGGAAGCCTGGAGCGCGA
GGCAGAGGCCTGACTCCCCCAGGCCGGTGGGAGGGGAGATGGCTCTCGTAGTCGGGAAGGGGTAGGAGTGAGATGTGGAG
CGTGCAGGGCGGGTCTCCCAAGGAGGGGACCGAAGCCAGTCGTGTGACCCTCTTCCAGGCTTANATTANCCNTACCCATA
GCCCCTATANCANCGTCTGCCCCCATTTCAGCTTGAANACCCN
Sequence Type genomic DNA
Unitrap ID UNI10807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46419378..46419659 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es