Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13077E1
Clone ID IST13077E1
Vector VICTR76
Project tigm

Sequence tag IST13077E1BBF1
Sequence
ATCTCATTGAATGTGGCTGTTTCAATGTGGTTTGCCCAGGGAGCAGGTTGGGGGAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78786418..78786478 61
NO GENE  


Sequence tag IST13077E1HMR1
Sequence
AGANNANGTCCCAGCCAAGCCACTACACAGATGTGACCTTTGCCCTCTGCCTTACAGACTCCAGCCTGTAATCTGCAGAG
GCACCTCTTGCTTTTATTATTCCTTANAAAATAAGACCTCAATCTGTCTTCATGTTGCTTTGAGGCTCCACATATCTTAA
AAACAAAAACAGCAGCCACCACCACCCCCACCAAACCCTGAAACTCTTTTCTTCCCAGCCCCTTCCTACTTTTATGTCTC
CCCCCACCCCCATTCGCCCGCTGGGTTTTATTACAGTTGCTTTTGCGTGCATGGGTGTGGAATTGTTTTCTGGGGCTTAN
CATGACTACACTGCTGAAAGGATATGACTTCCCTTTCCCCANCCNNCNNCTGTCAAAGGCAAGGTGGGGCCTCTCGTGGA
GACNNCCTNACTTGANCNNAAATCCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78785992..78786421 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es