Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11075B7
Clone ID IST11075B7
Vector VICTR76
Project tigm

Sequence tag IST11075B7HMF1
Sequence
ATTCCAGCAAATCTCCTCCCCTAGATCATTTCCTGATGTGTTCTCTGCCTTCTGAGGCAGAAGTAGAGTTCAGGAAAGCA
GTTGGCTCAGCTTTGATCCATTTTANNGGATGAATGTTTANNNNTAANCCTTTTGCTGCCATCCAGGATCTGACCTCATC
CAGTAAGTGTTCCACCGTCCATTATCGCCTTCCTGGATATGCAGTTCCTCCTCCAGGAAGGCANCAGTGTGGGGTGGCAA
GGGCACACAAGTTGCAGTGACTTTGGAGTTNACTGCATCTTCTCAAATTACTTTTTTTTCTGANCAGGGATTCTGACCAA
TCANNTGAGGCTAAACCTTTCTTGGTAGTTTGTTTTAAGGACTGAATGCAGTGAGCTTTCATGGTAGCTGTATGGGCTCA
CTGTGAGTTGAATCCNTGGTAGCACACATGTCCTTCTCACTCTTTANATGAAGTGTCCGGCCNGCTCATTCTTACCAATC
TCTCCCTGANCTCCTCTGGCACCTACCGATGTGTGN

Sequence Type genomic DNA
Unitrap ID UNI31871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37349492..37350007 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001943 (Vsig2) NM_020518 V-set and immunoglobulin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1928009]


Sequence tag IST11075B7BBF1
Sequence
ATTCCAGCAAATCTCCTCCCCTANATCATTTCCTGATGTGTTCTCTGCCTTCTGAGGCAGAAGTAGAGTTCAGGAAAGCA
GTTGGCTCAGCTTTGATCCATTTTAGAGGATGAATGTTTAGTTATTAAGCCTTTTGCTGCCATCCAGGATCTGACCTCAT
CCAGTAAGTGTTCCACCGTCCATTATCGCCTTCCTGGATATGCAGTTCCTCCTCCAGGAAGGCAGCAGTGTGGGGTGGCA
AGGGCACACAAGTTGCAGTGACTTTGGAGTTCACTGCATCTTCTCAAATTACTTTTTTTTCTGAGCT

Sequence Type genomic DNA
Unitrap ID UNI31871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37349492..37349797 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001943 (Vsig2) NM_020518 V-set and immunoglobulin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1928009]

 
Come back to gene ENSMUSG00000001943


For any suggestions or comments, please send an email to unitrap@crg.es