Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST462253
Clone ID OST462253
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST462253
Sequence
GAGGGAGAGGCTAGTGGTAACAGGCCGAGCTGGATGGATGGGTATGGGGAGAGGGGCAGGACGTTCAGCCCTGGGATTGT
GGCCGACCCTCGCCTTCCTTCTCTGCAGCTTCCCCGCAGCCATCTCCCCCTGCAAAATCCTCAAGTGCAACTCTGAGTTC
TGGAGCGCCACGTCATCAGGCAGCCACGCCCCTGCCTCCGACGACGTGCCGGAGTTCTGTGCAGCCCTGCGCACCTACGC
CCTGTGCACTCGGCGGACAGCCCGCACCTGCCGGGGCGACCTGGCTTACCACTCGGCTGTCCATGGCATAGAGGACCTTA
TGAGCCAGCACAACTGCTCCAAGGACGGCCCCACCTCACAGCCGCGAGTGCGCACGCTCCCGCCAGCTGGGGACAGCCAG
GAGCGCTCGGATAGCCCCGAGATCTGCCACTATGAGAAGAGTTTCCACAAGCACTCAGCTGNCCCCAACTACACTCACTG
CGGCCTCTTTGG
Sequence Type mRNA
Unitrap ID UNI16368

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80536265..80554490 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070509 (Rgma) NM_177740 RGM domain family, member A Gene [Source:MGI (curated);Acc:Rgma-002]

 
Come back to gene ENSMUSG00000070509


For any suggestions or comments, please send an email to unitrap@crg.es