Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14906G5
Clone ID IST14906G5
Vector VICTR76
Project tigm

Sequence tag IST14906G5BBF1
Sequence
CCATGTGGTTGCTGGGAATTGAACTCANGACCTCTGAAANANCN
Sequence Type genomic DNA
Unitrap ID UNI1758 UNI8682 UNI12161 UNI25630 UNI34551 UNI35779 UNI35780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7019472..7019510 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024959 (Bad) NM_007522 BCL2-associated agonist of cell death Gene [Source:MGI (curated);Acc:Bad-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21049265..21049303 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5047221..5047259 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20773944..20773982 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 46443051..46443089 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46080720..46080758 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3440073..3440111 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037486 (Asxl2) NM_172421 additional sex combs like 2 (Drosophila) Gene [Source:MGI (curated);Acc:Asxl2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8260344..8260382 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15087479..15087517 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8742924..8742962 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 34073669..34073707 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13765964..13766002 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038416 (Cdc16) NM_027276 CDC16 cell division cycle 16 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35023537..35023575 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28877683..28877721 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22989661..22989699 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029004 (Mll5) myeloid/lymphoid or mixed-lineage leukemia 5 Gene [Source:MGI (curated);Acc:Mll5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5709258..5709296 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88567147..88567185 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35418912..35418950 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5663095..5663133 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4468542..4468580 37
NO GENE  


Sequence tag IST14906G5HMF2
Sequence
CCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGAAAGAGCATTCGGTGCTCTTAAATGCTGACCCATTTGTTCAGCC
CTTTCTGGGGAATTTTAAAGATATATTTCTTTTCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3572708..3572853 146
NO GENE  

 
Come back to gene ENSMUSG00000049119


For any suggestions or comments, please send an email to unitrap@crg.es