Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST462179
Clone ID OST462179
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST462179
Sequence
ACGTGAGCGTGGCCTACGAGTGTCTGAGTGCCAGCGGCCGCAAGAAGAAACCGGGGCTGGATGGGCGCACGTACAGCGAG
CTGCTGAAGCGTGTTTGCAGGGACGGCGGGGCGCCTGAGGAGGTGGTGGCGCCACTGCTTCGCAAGATCCAGTGCCGGGA
CCATGAGGCTGTGCCTCTGGGCATCTTCAGAACCGGCATGCTGTCCTGCTTTGTGCTGCTGGAATTCGTGGCACGCGCCG
GCGCCCTCTTCCAGCTGCTGGAGGACCCTGGTCAAGCGGTGGCCGATCGGCGTGTGGGCCAGGCCGTGCTGGACACACTG
GAGGGTGCGCTGAGCGCAGGAGACATGGCAACAGCACCCACGCACTACCTGGAGGCCGGTTCGCGCTTGGGCCCTGACAA
CCTGGCGCGTGCCCTGGACAGGGCAGCAAGCGGGCGGCGACCCAGTGTGCC
Sequence Type mRNA
Unitrap ID UNI14420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79138162..79138612 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020308 (Gtrgeo22) NM_148934 gene trap ROSA b-geo 22 Gene [Source:MGI Symbol;Acc:MGI:106618]

 
Come back to gene ENSMUSG00000020308


For any suggestions or comments, please send an email to unitrap@crg.es