Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10900D7
Clone ID IST10900D7
Vector VICTR76
Project tigm

Sequence tag IST10900D7HMF2
Sequence
CCNCAACTCANAATCTGCCTGCCTCTGCCTCGCGAGTGCTGGGATTAAAGGCGTGTGCCACCAGGCCCGGCTTGTTTTTC
AAGGCTTTTATTTGCTTCATTTTGAGGGAGTATGAATCTAATGGGTCTTGGGGCCACACCCACTGTGACTTACTGGACTT
TTTCAACCTTGTCTTGCATGCCCTAATTTATAACCAAAAATGTTGAAATGTTCAAACATTTCCNGGCACCTATNTTTGGA
TTTAAAAANNNNNTNNNNTTTAAATTCCNTTACNAAAAANNNNNNTCNNNNTTTAAATTTNNAAATNNNATTTAGGAAAA
AAAANNTA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10900D7HMR1
Sequence
AGGCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCNNTACAGAGAAACCCTGTCTCGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84846324..84846395 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 39961945..39962016 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46498986..46499057 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 63461728..63461799 68
NO GENE  


Sequence tag IST10900D7BBF1
Sequence
GCCTCAACTCANAAATCTGCCTGCCTCTGCCTCGCGAGTGCTGGGATTAAAGGCGTGTGCCACCAGGCCCGGCTTGTTTT
TCAAGGCTTTTATTTGCTTCATTTTGAGGGAGTATGAATCTAATGGGTCTTGGGGCCACACCCACTGTGACTTACTGGAC
TTTTTCAACCTTGTCTTGCATGCCCTAATTTATAACCNAAAATGTTGAAATGTTCAAACATTTCCNNGCNCCTATCTTTG
GATTTAAAAAAAAAATCCANTTTAAATTCCNTTACAAAAAATTTAANTCCAACTNNAAATTTNNAAATCAAATTTAGGAA
AAAAAATNTTANNGTGTTTTTGANTGTATATGTNCNCGNGGGCACGTGTGNGCNATATCNGGGTGTGTGGAGGTCTNAAN
ANNTCTGGNTCTNACCTGTTTCTGTTTNNAGGCTTGATCTNTNTTNGATNGCAACCAATGTGAANTTTGNNNTGATTNNC
CTGCCTNTGNCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es