Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14930F12
Clone ID IST14930F12
Vector VICTR76
Project tigm

Sequence tag IST14930F12HMR1
Sequence
NAGACAAACCTTAGGGCCCTTCTGGAGCTTANGTCTAACCTGGAGGCCCANCCCCACTTTACCAAGGGTTATGGGAGAAG
GAGACAGCAGAGCCATGCCATGCCCCTGCTGCAGAGTAGCCCCTGGGCCCCTCAGCCTTTGGTGACTGCTAANCTTTCTG
CTCTTCCTTCCCAGCGGTTGAGGACCCAGCTGCCGCAGGACGCTGGGTGCCANNAATCNCCCACCTGTGGATGGGGGCAN
CCAGGTT
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74022234..74022477 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es