Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14862C3
Clone ID IST14862C3
Vector VICTR76
Project tigm

Sequence tag IST14862C3HMR1
Sequence
TTCCNNGTGCCTATTCNGGCNNNCTTACNNNNNNNNGGTGGATCNNNCCNNNCTTTGCAGAGAACAGGCCTCTTGTCCTG
GTTATCTTACTGTCCTACTGCTAACTTANAAAATGTGACGCTTTGAAACCCATCAATGGGTTCACAGATCGTCTGGGTGG
GCACTGAGGTGGCTCANAGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65807733..65807862 126
 
EST/CDNA Est Name
  AW213117.1


Sequence tag IST14862C3BBF1
Sequence
GAAGGGTATCAGGTGCCTATCATACGGAAACAGTGTGTGCCCTATCGTAAAGGTGAAGAAGACCCACTGTGGTTCCATGG
TGCACTCTTGTTATGCACAGCTGAGCTTTACCCCAGTGAAGCCTGGGTGAGGGGTGGGGTTTGAN
Sequence Type genomic DNA
Unitrap ID UNI14034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65807539..65807682 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029201 (Ugdh) NM_009466 UDP-glucose dehydrogenase Gene [Source:MGI (curated);Acc:Ugdh-001]


Sequence tag IST14862C3HMF1
Sequence
GAAGGGTATCAGGTGCCTATCATACGGAAACAGTGTGTGCCCTATCGTAAAGGTGAAGAAGACCCACTGTGGTTCCATGG
TGCACTCTTGTTATGCACAGCTGAGCTTTACCCCAGTGAAGCCTGGGTGAGGGGTGGGGTTTGACTGTGGGTGGCCTCNG
ANNAANNGNNNCNCCNGGAACAACACTGNCNNCCNCCNGTGANAATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029201


For any suggestions or comments, please send an email to unitrap@crg.es