Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11637D1
Clone ID IST11637D1
Vector VICTR76
Project tigm

Sequence tag IST11637D1BBF1
Sequence
GTAGCTATTTCAGAATCAGACTGCAGGGCACTTTGATTTCCTGTGTGTGTTTCCATGANACATGCACACACACANTCNAA
CCCCCTTANCNNTGANATCCACATTTACAGATTCNNCCNACCGNANGTTGCAACTATTTTTATTTGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11637D1HMR1
Sequence
GCTACCTTCCNAACCTTTTTGTTCTGGGATCCACCCTTGGGCAGGGGCAGTCGTGGATGCATACCTTCCTGGAAGAGTGA
CCTTANAACTTTGCTGTTTTGAGATCTGGTATTTTTCCATACATAATAAAACCCTTTTTTCTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99315549..99315702 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST11637D1HMF1
Sequence
GTAGCTATTTCAGAATCAGACTGCAGGGCACTTTGATTTCCTGTGTGTGTTTCCATGANACATGCACACACACAGTCAAA
CCCCCTTANCCATGAGATCCACATTTACAGATTCAGCCAACCGCAGGTTGCAACTATTTTTATTTGGAAGATCTANAATG
GA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99315698..99315858 155
NO GENE  

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es