Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15099F12
Clone ID IST15099F12
Vector VICTR80
Project tigm

Sequence tag IST15099F12HMR1
Sequence
NNNNNTCCCCTGTTACAATTGTACAGAGCATGTTTGTGATGCNATCCCTGCCTCTCTGGAGGATGTGGGGTTTTGTN
Sequence Type genomic DNA
Unitrap ID UNI35591

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 170359189..170359259 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052534 (Pbx1) NM_183355 pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]


Sequence tag IST15099F12HMF2
Sequence
TAAAAAACAGGATTCAATAAAGTATAACTGCTTTTTAGTTGTTGGCACTTTACTAATTTAGTCCAGAATGACTTATTAAA
ATCAATAAGTAACCAGATTAGTTTTCTTATAGCCTTATGGTTTTGATTTGGTTGTTTCCTCCTTAAAGGCTTAAATTGTA
ATCTCCTGTTTTCTGTTATTATTATTATTTTTTTCTGTAAACTGAAAGCTAGGCCTTTAGCAAATAGGTCAGTAATGATG
CCTTTAAAGACTCCAATGTCTGTGTATTTTCTTAGCAGCATTGCTACGCTCTCTGGTCGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21157669..21157974 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST15099F12BBF1
Sequence
TAAAAAACAGGATTCAATAAAGTATAACTGCTTTTTAGTTNTTGGCACTTTACTAATTTAGTCCAGAATGACTTATTAAA
ATCAATAAGTAACCAGATTAGTTTTCTTATAGCCTTATGGTTTTGATTTGGTTGTTTCCTCCTTAAAGGCTTAAATTGTA
ATCTCCTGTTTTCNGTTAA
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21157669..21157846 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es