Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14747H7
Clone ID IST14747H7
Vector VICTR76
Project tigm

Sequence tag IST14747H7HMF1
Sequence
TTTCAATTCCAGGGATCAAACACGCGGAGTTCACTGGCTCCCTGAAGTCCTGGGTAACCGTTGGTTTTGCTCACCGTAGT
TACCCCAGGGCTTGACTTCTGCGAGAGCTGAGCTTGTGAACAGCCGCGTGCAACGAACTTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4077343..4077488 146
 
EST/CDNA Est Name
  CX233696.1


Sequence tag IST14747H7BBF1
Sequence
TTTCAATTCCAGGGATCAAACACGCGGAGTTCACTGGCTCCCTGAAGTCCTGGGTAACCGTTGGTTTTGCTCACCGTAGT
TACCCCAGGGCTTGACTTCTGCGAGAGCTGAGCTTGTGAACAGCCGCGTGCAACGAACTTGTCAACCCAAGCGCGGGAGC
GTCTGCAATCAGGACTACCAGGGACTGACGAGAGCAGGCTGTGGCTGCCCGTGACTCGGCTCCCCAAAAGCGACCACAAG
GTCCTACTCCCCGCCCCACTTAGCAGCTCCGGCGCAGTGCGGCCTCCCGCCGGTCTAAGAGTGTGCACACAGCCTCAGAC
GCCGCCTCTGCGCTCTNNNNNNGCGCTCACCTCGCCGAACTCCANCCNGCGCGGGGGCCCGNAGTACANTCTGCANCNNN
CNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4077343..4077737 375


Sequence tag IST14747H7HMR1
Sequence
NAAAGAGAAAGGAAAGGAGAGAGAATAACCTTAATCTATACTTTCCCACCCCGCACTCATGTAACAGTGAAGATGTTAGC
GTTACATACACTTAAATTATACGTATTTACAGCTATTTTTACATAAAAGGGCTCAAGTCAAGAATTAACTGCGAAAGAAT
ATTAAAGCTTCTGGCATTCATTACATTTATGTTTCGCATAAACATAGCTTCCCAATGGCTTTCCGAAGTTTTGTCGCTCT
CATCCTCCACTAAATGTTCTCTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI23013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4077080..4077345 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es