Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14711C10
Clone ID IST14711C10
Vector VICTR76
Project tigm

Sequence tag IST14711C10HMF2
Sequence
CACTCACCTGGGCATCAGCCACTTGAATGTGGCAGCCAAGCCTGAGATGGCAGCACTGGCTGGAGGTAGCCGGTTGGCCT
TTGAGCCACCCCCGCCACGCCTCTCCCACCTGCCTGTAGCCTCCAGTGCCAGCACAGTGCTGAGTACCAATGGCACGGGG
GCTATGAATTTCACCGTGGGTGCACCGGCAAGCTTGAATGGA
Sequence Type genomic DNA
Unitrap ID UNI33315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26315760..26315960 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es