Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10727F6
Clone ID IST10727F6
Vector VICTR76
Project tigm

Sequence tag IST10727F6HMR1
Sequence
ACCTTTCTGCCTTTTGTANTTTACTGACTTTAAAGAAAAATTTGAAATGGGATTGTANCTTTAGTAAGAGATCTAATTGT
TACCTTGCTTAGGGGAAGGGGACTCTTCGGGGAAGAAAGTAAAAGATTGTATCTTTGAGATTTATATGCGGGTTCCCTAG
GCTGCTCTGTGAATACACCAGCTGCTTGAAAAGCTCTTCTGTGGAATCTACACATAGGAAACTCGAGTAGGGAAGGGGCT
GGGTCCTTCTGGTCTGTTGTAACTGGGCGGCTCANGCNNGCCANNGANACCTGANCTTTGGTGAANTTCCNGCCNANNAN
TN
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473690..127474003 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es