Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14161F10
Clone ID IST14161F10
Vector VICTR74
Project tigm

Sequence tag IST14161F10HMR1
Sequence
GTCNTAGGTGTCTCAACTTTGATGAAAAGTAGAAATTCCCTATTAGCTTGCTGAGATGCCTCCATCCACTATATGAATAG
TCAGAATTTCCTCC
Sequence Type genomic DNA
Unitrap ID UNI23296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36978856..36978948 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024457 (Trim26) NM_001025599 tripartite motif-containing 26 Gene [Source:MGI Symbol;Acc:MGI:1337056]

 
Come back to gene ENSMUSG00000024457


For any suggestions or comments, please send an email to unitrap@crg.es