Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14043H1
Clone ID IST14043H1
Vector VICTR74
Project tigm

Sequence tag IST14043H1BBF1
Sequence
GGAGAAAAAAGCGGCTNANNANGAAAGAAAAGGATACCAGCCGCCNNNNNNAGNGCTAACTAGTNNNCNAAGGAAAAAGC
CAAAAGCGGCTGGCGAAGGCCANNNTGCTAATTGGCCTCAGGGCAATCGGCTACCAGGTGCACTCCCGCCCTATGCGNNN
NCNCCGCCCTGCGTAGTGCGTCAGCCCGTAGTGCGTCAGCAATGCGCAGAGAGGCAGTGCGCANACTCATTCATTCCCCG
AGAGGAACAAAGGAAAATAGAACAGGCATTTCCAGTCTTTGAAGGAGCCGAGGGTGGGCGTGTCCACGCTCCGGTAGAAT
ACGTACAGATTAAGGAAATTGCCGAGTCGGTTCGTAAATACGGAACCNATGCTAATTTTACCTTGGCGCAGTTAGACAGG
CTCGCTGGCATGGCACTAACGCCTGCTGATTGGCAAATGATTGCAAAAGCCGCTCTCCCTAATATGGGCNAATATTTGGA
ATGGANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14043H1HMF2
Sequence
GGAGAAAAAAGCGGCTCATTATGAAAGAAAAGGATACCAGCCGCCAAGTAAAGTGCNNNCTN
Sequence Type genomic DNA
Unitrap ID UNI34590 UNI35786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 53061144..53061199 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60692258..60692313 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 50217052..50217107 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039316 (Rftn1) NM_181397 raftlin lipid raft linker 1 Gene [Source:MGI (curated);Acc:Rftn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32149171..32149226 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39005591..39005646 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98619012..98619067 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 69847246..69847301 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29025547..29025602 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8629368..8629423 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031997 (Trpc6) NM_013838 transient receptor potential cation channel, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:109523]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 81026537..81026592 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58845555..58845610 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 103885527..103885582 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18708615..18708670 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 15560024..15560079 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21707977..21708032 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51908640..51908695 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60297962..60298017 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76934871..76934926 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84346356..84346411 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 112226629..112226684 56
NO GENE  

 
Come back to gene ENSMUSG00000031997


For any suggestions or comments, please send an email to unitrap@crg.es