Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST461924
Clone ID OST461924
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST461924
Sequence
GACTGAGATAACACGGAGGATCTTGAGGNTGACCTTGTGGTAAATGGGGAGAGATCTGACTGTACCCTGCCGGACTCTGT
GTCATCAGGGAACAAAGGAAGGGCTAAACATGGAAACGCGGAGACCAAGCAAGATGGAGGGGCCACCAAAGCAGGGTCCT
CGGAACAGTCTAATGCAAGTGGCAAACTCCGAAAGAAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI8274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125905298..125906461 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001472 (Tcf25) NM_001037878 transcription factor 25 (basic helix-loop-helix) Gene [Source:MGI Symbol;Acc:MGI:1914105]

 
Come back to gene ENSMUSG00000001472


For any suggestions or comments, please send an email to unitrap@crg.es