Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14968C11
Clone ID IST14968C11
Vector VICTR76
Project tigm

Sequence tag IST14968C11HMR1
Sequence
CCAAGGTCTTGTGGCTCACAGGCTCCTGCAGCCTCAGCACTCTTAAACGCGTTCTCACGACCGGCCAGGAAGAACACAAC
AAACCAGAATCTTCTGCGGCAAAACTTTATTGCTTACATCTTCAGGAGCAGGAGCGCAAGCCCCCAAGCCCAAAAACGAA
AG
Sequence Type genomic DNA
Unitrap ID UNI29404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41695572..41695733 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]


Sequence tag IST14968C11BBF1
Sequence
TTGGGAAGGGTANTACACGCCCTTAAGTGCTGANCNNTCTCTTTAGCTCCATGAAACACAGCTCCCCTGATCCCCTGAAT
TAAGTCTAATATTGCAGGTTTCACTTCTTCTTTGACCCACAACTATTTAATAAGCATANTTTGTCAGTTCCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41695730..41695882 143
 
EST/CDNA Est Name
  BQ963919.1 - CJ161889.1

 
Come back to gene BQ963919.1 - CJ161889.1


For any suggestions or comments, please send an email to unitrap@crg.es