Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10818F3
Clone ID IST10818F3
Vector VICTR76
Project tigm

Sequence tag IST10818F3HMR1
Sequence
CATTAGGTCCACAGTCCAAAGATGGTCATCTAATCCTGTGTCTTGCCCATCTATGGTTTGGGTTCCTTGACTGCCTCTCT
GCTAGTTCTAAAGATCCATGAAATGGTGACAGGATAGTAAACTAGAGACAGGAGTAGTATAGTANCTACCCCTAGTCACC
AAGAGGGGAAGGTTCTGGTTCTGAACTATAATAGAATGTATTGTCATTCCCTCAGGAAAGCTCACTGCTACTCTCTGGGA
TTGGATCCCATGACTCTTAACATTGATGCTCTGATTCATCCTTCTCTCTTCCTANGCTCTGTTTTGTAGTTCACTANTTT
GCCTANATTCTCTCCCACNGTTGAAAGACATANCTCTTCATTTN
Sequence Type genomic DNA
Unitrap ID UNI278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30920709..30921071 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es