Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12653D1
Clone ID IST12653D1
Vector VICTR76
Project tigm

Sequence tag IST12653D1BBF1
Sequence
ACGCCAGCTTAAGCTCAAACCCAGAGCAGTTTGCCGGCTTCCGCCTCCCACGTGCCAGGATGACAGCACT
Sequence Type genomic DNA
Unitrap ID UNI35790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114495655..114495724 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031949 (Adat1) NM_013925 adenosine deaminase, tRNA-specific 1 Gene [Source:MGI (curated);Acc:Adat1-002]

 
Come back to gene ENSMUSG00000031949


For any suggestions or comments, please send an email to unitrap@crg.es