Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST461789
Clone ID OST461789
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST461789
Sequence
CGCATTACAAGTTTCAGAAAAATCTGCCACCAAGCAGGAGAAAAGCCTGTTATTCAACATTCTATTGATTATCAAACTGC
AGTGGTTGAGATTCCCCCAGCTCTGATAGTACATGATGACCGATCTTTGATTTTGTCTGAAAAGGAAGTTCTGGACCTCT
TTGAGAAAATGATGGAAGATATGAACCTTANTGAAGAAAAGAAAGCTCCTTTGCGAAAGAAGGATTTTAGCATCAAGCGT
GAGATGGTTGTCCAGNATATTTCTGCTACTTCCAAATCTATAGCTGGAANTANAGCNCTGGNNGNCCTGAANGCANNAAA
CATGANNNCACCCTGTCTTCACAAGANNATNTTCATGAATTATGACCTGACATCACAGATGA
Sequence Type mRNA
Unitrap ID UNI16393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126338555..126437518 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es