Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10103A12
Clone ID IST10103A12
Vector VICTR76
Project tigm

Sequence tag IST10103A12BBF2
Sequence
AGCCCTGGCTGTCCTGGAACTCAGTCTGTAGACCAGGCTGG
Sequence Type genomic DNA
Unitrap ID UNI35791 UNI35792 UNI35793 UNI35794

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36653648..36653688 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62397837..62397877 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53628257..53628297 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081769 (RP23-303F24.3) Novel protein [Source:UniProtKB/TrEMBL;Acc:A8Y5C0]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3511720..3511760 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49684529..49684569 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048368 (Omd) NM_012050 osteomodulin Gene [Source:MGI Symbol;Acc:MGI:1350918]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54419935..54419975 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81487951..81487991 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15903645..15903685 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27800592..27800632 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36472372..36472412 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6956101..6956141 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91465146..91465186 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 46516983..46517023 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62122720..62122760 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028391 (Wdr31) NM_023597 WD repeat domain 31 Gene [Source:MGI (curated);Acc:Wdr31-006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65618637..65618677 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72863823..72863863 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4290851..4290891 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062524 (Ncr1) NM_010746 natural cytotoxicity triggering receptor 1 Gene [Source:MGI (curated);Acc:Ncr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11042598..11042638 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21946070..21946110 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 14170915..14170955 41
NO GENE  


Sequence tag IST10103A12BBR1
Sequence
ACTAATCTTCTACTTCAGCTGTCAGGAGAGAGCAAGTGGGTTTTATTTTAAGCTGTCAGGCCAACTTTAGTGTTTGCTGA
AACTTAAAAAAAAGAGAGAGAGAGAGAGAGCATCTGTTTTTGAAAATGGAAACCTGGTGCTTGATACCCACTCTTTGTTT
TTAAAATGCTCCTAAATCTAGAGGACTGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33440673..33440865 189
NO GENE  

 
Come back to gene ENSMUSG00000062524


For any suggestions or comments, please send an email to unitrap@crg.es