Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14388A11
Clone ID IST14388A11
Vector VICTR74
Project tigm

Sequence tag IST14388A11HMR1
Sequence
AAAGGACAAGGGTGTGAGGGAATCTGCCCAGAGGGTANAGCCAGCCTCTACTATTCTGCTAGGACCAAACTCCTCCTGAA
GTTCATGAGGACTGCTACATAGAGGAACTTGGTGGAGTAGGGACTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79990952..79991080 127
NO GENE  


Sequence tag IST14388A11HMF1
Sequence
AGCAGAGGTCACCCTGCCTGCCGGGAACCCACAGGGATTCTGGATTCCTCCCCACCCAGAGGGAAGGCTATTTTTAGTGT
TCTCTTTTTCCTCAGCCCTCTCTGTCTCCCTCCTCTTCACCCCAGATGTGTTTGTCACAAGGAGACTCTTCCCATCTGTT
C
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79991113..79991272 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es