Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11669H10
Clone ID IST11669H10
Vector VICTR76
Project tigm

Sequence tag IST11669H10HMR1
Sequence
CTGCTCCTTAATTTAAAACTATTANTTGAATAAAGATGCCTATAGCTGGGCAGAAGAGAGGTAGTGGATCTCTGGTTTCT
AGGGATTANGGTCTGAGGCAGAGGCTGGAGGAANAGGANAGAGAGAANAGAGGAAGACNCCATGGAGTAAGGC
Sequence Type genomic DNA
Unitrap ID UNI14032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77553203..77553354 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]


Sequence tag IST11669H10BBF1
Sequence
GGGGACCAGTATTTAGCATTATGATACATGGCAACATACCAAACCTCAACACTGGAGATCAGGCAGGTCTCAAACTCAGN
NATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77553059..77553143 81
NO GENE  

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es