Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14518D10
Clone ID IST14518D10
Vector VICTR74
Project tigm

Sequence tag IST14518D10HMF1
Sequence
ATGNNNNNNTNNNCTTNNNNNNNANGTNNGCTGCNNNTNNGTTTTNNNNNANCNNNNNNACTNNNNCCNNGTAAATTATT
TNNNAATCAGGTCANNTNCAAGCTCTNNNANNANCAAANCAAAATCTCTCANNATTAANTTTAAAACTNNNTTTANNAAC
TGAACACANGGCTGTTGGTATANCTNANTGGTAACGTACCTGCCTANGATGTATGAGGCCTTGGGTTANATCACTANNAC
TGNNNAAACAAANCNCNACCAAANAATTAAATACNAATAANCNTACNNTATGAACTNNNCTAATTGACATACTGAAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14518D10HMR1
Sequence
GACACAATATTATAGTGTCAGGAAAATTAAGGAAATGACTGCTGATTTGTTTAAACTTAAAAAGCTACATATGGGATTGC
ACACACTTTAAGTATATGTTGTGAGCAAAACGTTCTTGTAATAGTAGCTGTCATCTTCTATTCCCTGAGGAGGCTTAGAT
GCTCCCTACTATCACATGAGGAGTTAGGATTCCCGAAAACTAAATTCTCCAAGGGATTTTTATGTANATTATCTTCCACA
CNCCCTAGGAGAGAAGTGGGTGTGAGTGGATGTANAAAATCTTCTCANCAGTTGTANAN
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35523380..35523675 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


Sequence tag IST14518D10BBF1
Sequence
GTGTCCATCAATACAGCAGCAAATAGGTCTGCTGCCAACTTGTTTTCCATGACCTGATTTACTTTAGGCCAGGTAAATTA
TTTCAAAATCAGGTCAAGTACAAGCTCTCTGAATAGCAAAGCAAAATCTCTCAAGATTAAGTTTAAAACTAAATTTAAAA
ACTGAACACAGGGCTGTTGGTATAGCTCAGTGGTAACGTACCTGCCTAGGATGTATGAGGCCTTGGGTTAGATCACTAAG
ACTGTAAAAACAAAACACTACCAAAAAATTAAATACAAATAAGCATACAATATGAACTCAACTAATTGACATACTGAAGT
AATATAGGCAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35523040..35523384 345
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es