Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14317E7
Clone ID IST14317E7
Vector VICTR74
Project tigm

Sequence tag IST14317E7HMR1
Sequence
NAGACTTGAATATGTATCTACCGGAAAGGATTTCATTTATTGAAAAAAGGACAGCCCTGCAACCAGGGCCCTCANTAAAT
GGAGGCTTGTTTTCCTTAAGCTACAAGAAATCTCGATAGAGGTCAGCTGTTGGGCGCGACAACAGCTTAATCAAGTCAAG
AATTCCACTTAGATCTTTCATTTGCCATTCTTATTAGTGGTTCTCTGTCCTCATGGTTGTAGGGTGGATGCTGTACCCCT
TGACCGGCCATTANNTCTTNNTTCCNNGCAGGGTGGGANGTTTTTGCGTTCTCATCNNACTTTTGCTTCTTTCTCAGTGG
N
Sequence Type genomic DNA
Unitrap ID UNI19577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93114323..93114641 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es