Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406H3
Clone ID IST11406H3
Vector VICTR76
Project tigm

Sequence tag IST11406H3BBF1
Sequence
AGTGCTGGGATCACAGGCACTANTTACTATGTTCCTNCATCACCATAGTTTTGTGATTAAAGAAATTACTGTTGGGAATG
GGTGCACAACTCCAACCAGAACTATGTGGTCACATCCTCTAGGGCTGATCCTTAGTGTCATCTAGGAAATGACATCANAC
ACNNCTAGAACTCAAGTTTCAATGCCNAGGTGCTACAGGAAAATCTTAAGTACTTCCTACAGAACATAAACATGGAGACA
TTTAAAACTGGGTGTGTCTTANGCATGTGATCCTANNACTTGGGAGGTGGAANCANGAGGTTGGGGAGTTNNNGGTCAGC
CTANACCACACAAGAAGACCCCGTCTTTTAAGAACNNCNNNAAAGGGCTGGACATGGTGGTTGACACCTAAAGCCCANCA
TTCAGAGGCANACAGACNGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11406H3HMF1
Sequence
AGTGCTGGGATCACAGGCACTANTTACTATGTTCCTNCATCACCATAGTTTTGTGATTAAAGAAATTACTGTTGGGAATG
GGTGCACAACTCCAACCAGAACTATGTGGTCACATCCTCTAGGGCTGATCCTTANTGTCATCTANGAAATGACATCANAC
ACAACTNGAACTCANGTTTCAATGCCNAGGTGCTACAGGAAAATCTTAAGTACTTCCTACAGAACATAAACATGGAGACA
TTTANAACTGGGTGTGTCTTANGCATGTGATCCTANNACTTGGGANGTGGAAGCANGANGTTGGGGAGTTNNNGGTCANC
CTANACCACACAANAAGACCCCGTCTTTTAAGAACANNNNNAAAGGGCTGGACATGGTGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11406H3HMR1
Sequence
CACTGGANAGGCANAGGCAAAGGAAATAGGAGTTCAAGGCTAGCCTAAGCTACATTATGGGTTTGAAGCCACCAGGAGTT
ACGTGAGATCCTGACTCCAAACAAATTATGATAGTCTTAGAAAGAACTTGCCAGTTAGTTAAAGACCACCAAAAATGTAA
AAGACCCTGTGAAGTTTGTACTCTCTTTGATCTGGGGAACTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI33281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110151865..110152071 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032482 (Cspg5) chondroitin sulfate proteoglycan 5 Gene [Source:MGI Symbol;Acc:MGI:1352747]

 
Come back to gene ENSMUSG00000032482


For any suggestions or comments, please send an email to unitrap@crg.es