Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506C3
Clone ID IST14506C3
Vector VICTR74
Project tigm

Sequence tag IST14506C3BBF1
Sequence
GTTAACGTTAGTTTTCTTTGTCTTTTATTGTTCTTTTTAATTCATCTGCGAGTGAGGGCTATAANACAAGGGTACTGGGT
TTTTCTCGGAGCACAATGGGTAAAGGAGGAAGGGGTTCACATTACATTTGCCAAAGAGCAGGCATCTGGCCAGAGTAGTC
ATCAGCTCTTTTCCCCAATAACGGACCTCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62351695..62351890 194
 
EST/CDNA Est Name
  BP753711.1 - AI838029.1 - Z31141.1 - AA739245.1 - AA738589.1 - CK137360.1 - BU583653.1


Sequence tag IST14506C3HMR1
Sequence
AACCCAACAATTGTTTAACAACCTGAACTACTTTTNATAACAACAAGATGCTCTTTTGTCTTTGTCCCAGAATTAGTTCT
CTTGGTTTTGGTGGATCCTCTAAGAACTGGAGTATTTAGTTAGCTTTCTATCTGTTTCGTTTATTCAATTTTATCCCCTT
GGGCTATAAATTGAATGCT
Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62351519..62351697 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es