Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841G8
Clone ID IST14841G8
Vector VICTR76
Project tigm

Sequence tag IST14841G8BBF1
Sequence
AAGACAAAGAAGCTCTGGGCCCTCACGCTGCCGCGACTAGCGCACCGACTCTGGACTTCTCTCATCAAACCAACCCCTCA
AGTGGACAGGGTCGGGAGAGTTCAGAGCAGGACAGCCGCAGTTCAACCGACGCCCTAGCTCGGCGAGAGGCTGCACCGCG
ACTCGACGGGCGGTGGCTACCAAGGGGTTCCAAGGAGAGCGCGCCGGACCCGGGCCCCCCGCCTCGGCGCGCGTCTCGCC
CCGCGAGGGCGTCTCGCAGGTGGGGAGGTNCACGGCTTCAAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179760161..179760444 282
NO GENE  


Sequence tag IST14841G8HMR1
Sequence
GTCTTCTTTCTCCGCGTTAAATGGGGCGCTTGTTTCCTTCGGCTCTCCAGAN
Sequence Type genomic DNA
Unitrap ID UNI1539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179760440..179760490 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039108 (Lsm14b) NP_808395 LSM14 homolog B (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14b-002]

 
Come back to gene ENSMUSG00000039108


For any suggestions or comments, please send an email to unitrap@crg.es