Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0258
Clone ID DC0258
Vector pGT1lxr
Project sanger

Sequence tag DC0258
Sequence
CCGCCGCGGGCGCGCCCCCGCTTCTGCGCTGCGCTGTCTCCTATGGCGTCCGCCTCCGGGGCCATGGCGAAGCACGAGCA
GATCCTGGTCCTCGACCCTCCTTCAGACCTCAAATTCAAAGGCCCCTTCACAGATGTAGTCACTACAAATCTTAAATTGC
AAAATCCATCGGATAGAAAAGTGTGTTTCAAAGTGAAGACTACAGCACCTCGCCGGTACTGTGTGCGGCCCAACAGTGGG
ATTATTGACCCGGGGTCAATTGTGACTGTTTCAG
Sequence Type mRNA
Unitrap ID UNI3071

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65944242..65962679 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024091 (Vapa) NM_013933 vesicle-associated membrane protein, associated protein A Gene [Source:MGI Symbol;Acc:MGI:1353561]

 
Come back to gene ENSMUSG00000024091


For any suggestions or comments, please send an email to unitrap@crg.es