Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST461680
Clone ID OST461680
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST461680
Sequence
ACTGAGCAAGATTACCTTATGCTGGCTACTTTGGATGAAAATGAGGAAGTGGTGGATGGGGGCAAAAAGGGAACCATTGA
CGACCTTCAACAAGGTGAACTGGAGTCATTTATTCAGAATCTGAATTTGGCCAAATACTCAAAGTCTTTGATTGAAGAAG
ATGAACCAGAGAAAAAGGAAAACAGCCAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 79335216..79335409 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024081 (Cebpz) NM_001024806 CCAAT/enhancer binding protein zeta Gene [Source:MGI Symbol;Acc:MGI:109386]

 
Come back to gene ENSMUSG00000024081


For any suggestions or comments, please send an email to unitrap@crg.es