Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST461678
Clone ID OST461678
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST461678
Sequence
GAAGTGGTCCTGAAGAGAANCTTATTTGTTTGGTTCGTGAGCGTGTAGACCATCACTGTTCGACGGCTGTGATAGTTGTC
CTTATCCTGCTGTGGGAAGGTATCCCTCGCCTGATGGCTGACCGCCTGTACAAAGAGCTCACTGAGAACTTGAGGTCCTA
CAGCGGACATCCCACAGACCGAAGATGTACCCTCAACAAAAAGTAATCAGACCTGCATTGTTCTCCCTCCCTCTGTTGTG
AGCAGCAAATTGATAAGTAACTGCCAACTGAGACTAGCCTGTGAGTAGCAGGACTCTAAAGTACCATGGAAGGAAAACGG
ACCCACAGGGTCCCGTGCTGCACACCGTGGGAGGCAGCTGGACTTCCATGAGTTGGAGCTACATCTGCACAGGGAGACCT
TGTGTTTCTTNTCCCCCTACACCTGCAGTGCAATTAAGACTATTTTGCTGGGACTGGCGCTCAACAGCTCAGAACACTGA
CCG
Sequence Type mRNA
Unitrap ID UNI875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62285016..62285498 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047146 (AC166359.3) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9CY36]

 
Come back to gene ENSMUSG00000047146


For any suggestions or comments, please send an email to unitrap@crg.es