Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14229G10
Clone ID IST14229G10
Vector VICTR74
Project tigm

Sequence tag IST14229G10BBF1
Sequence
GGTAAGAAGACCTGCAACATCACTTGTTTCAAAGGCATGAATTAGCTCATAGAAATAATCATAGGAACCTTCCCCACTTT
CAAACCTGTGTCTGTAGGATTGGGAGCTGAGGATGAGCAGTGGAGGGGCTGCTCTGCATGGTCCCACTCCCAGGCTCCTT
GCTGGATGCCTGAAGAATGACTGGGTTATCACCGTTGCTGCAGGCCGAGTGGCTGGTGTCCGGCTGCNNGGCATGCTGGG
AGCTGGCCTCNTTCTGGGCCNCCANCCACCGGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134659526..134659800 265
NO GENE  


Sequence tag IST14229G10HMR1
Sequence
TACCCACCTAAGTTTAGACTCTCTTTAGTTCTCAGATAGATTGGGGAGTAACATGTCAAGCCTAATTTTTTCTTCTTTAA
TTTGGTTTTCTGAGATAAGAGTTTTCCCACCTACTGTCTTGGAACTTGCTCTGTACACCAGGCTGGCCTTGAACTCAN
Sequence Type genomic DNA
Unitrap ID UNI14763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134659797..134659953 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es