Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0254
Clone ID DC0254
Vector pGT1lxr
Project sanger

Sequence tag DC0254
Sequence
ACTGTGATCAGAGCCCAGAAGACCCAGAAAAGGACAAGCAGGAGGGCGAGAGCAAGAGGTCCAAGCAATATCAGAACAGC
ACGGAGGAGGCGGAGGACCCTTCCGCAGACAAGGACGCTGACAGCAAAGGCCTGGAGGAAGAGCCCGGGCATGGAAAACC
TGAGGAGCCAACAGAAGTTGGGGATAAAGGTAACTCTGTGCCAGCAAATCTTGGCGACAACACAACAAATGCTTCTCCAG
AAGAGACTAGTCCCTGTGACGGGAGGAGCCCCGAGGGCTGTCTCTCAGAGACCCATGATAGCAGCAGCATGGCAGAGAAG
AAGGTGGCATCTGAGCTCCCCCCGGATGTACCAG
Sequence Type mRNA
Unitrap ID UNI3072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106956316..106957194 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es