Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841B10
Clone ID IST14841B10
Vector VICTR76
Project tigm

Sequence tag IST14841B10HMF1
Sequence
CCAGTCCTCCTCTTCTCTCCCTCTTCACCACCCCCATCACATCCAGTGTCCCACAGAGCACCCCTCCATTCCATTTTGCC
TGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286845..148286977 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14841B10HMR1
Sequence
CTGGAGAAGAGGGAACGAGGTCTATTAAAATCCTCTCAGTGCATAACACAAAATGTCAGGGTTTATAGCTTCATTCTTGG
CTTTGCTGGGACTGAGAACCCTGAACAGAAATGTCACCGCTTGTCATGTTTAATCACCTGCTGTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286700..148286848 149
NO GENE  


Sequence tag IST14841B10BBF1
Sequence
CCAGTCCTCCTCTTCTCTCCCTCTTCACCACCCCCATCACATCCAGTGTCCCACAGAGCACCCCTCCATTCCATTTTGCC
TGACTTTCAGGAGCCATCTGGGCTGTATGGGTCTCTGTACCTGCAGGTCCTGGCCAGATGCCCCCCTCCCCACACCTTCT
TGGTTTTGATCTTTCCTGTTGTCCCTCTTCAAACCCCCCTTGCCTCCCTCCACCGTCCACTTTCTCACCTCCTTTTTTTG
GGTCCTGATCTCACAGCCTGTCCCTTANCTGCGGCTGTCCCAGTTGTCAGGGACAGCANGTGGCTGTCCTTGTGCTCTTT
GTGCTCATANCATTTCCNGACAGACNTGANANCGGGTGTANGGANTTNGNGA
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148286845..148287211 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es