Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14414E12
Clone ID IST14414E12
Vector VICTR74
Project tigm

Sequence tag IST14414E12HMF2
Sequence
GGAGCTCTTGAATCANATCTGTAATCTCGGTACCCAGGAATCTGAGGCAGGGGGATCACTGTGAGTATGAGGCCAGCCCG
TGCATCCCAGTGAGACTGGTTTCAAAATAAACAAGCAAATAAACAGTGAGAGACAGCAGCAGCAGCAGCAGTGCAGTTCC
TTCCAATCCTGTTTCTGACCGGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88258884..88259069 184
NO GENE  


Sequence tag IST14414E12BBF1
Sequence
CTCTCTGTCCTTCTATACCTTTATAGACACAAGTTCTTTAGAAAATTATCTCATAGATAAAATTTATAAAAAGGAAAGTT
ACAGTAGAATGTTGATAGTTAATTTCAAAGCAGTGTTTTATTCTTTAAGCTCAAAACAACAGTTTATCCATGGTCTTGTT
CATCATATCACACACTTGTGGCTTCATCCTTGGACCTGATCTAGAATGAATATTTTTCCTTGATCACAAATTTGTCCCAA
GCATGTCTCTTTTTGGTGTAGTTGTGAAAGCTCATTGTATTCTTTATTATGCAGCCTTTACTTACTTTTCTTTTTGTTTT
GTTTTTCAAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTANACNAGGCTGTCCTCGAACTCNN
AAATCCNCCTATCTCTGCCTCCGAAGTGCTAGGATTAAAGGCATCTGCCACCACTGCCCANCNNNNNTCNATTCTTGANT
CTGACGTTATNNCATCTTTCTGGCNNACCNNCTAAACTNTCTCCN
Sequence Type genomic DNA
Unitrap ID UNI21618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75189194..75189717 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]


Sequence tag IST14414E12HMR1
Sequence
NTTTTGTTTCCTCTCTATATTTATGTTCTCAAAACAAAGAACCCAGANAGTCGGAGCGCAGCGTCTTCCGCTTGTTCTGT
CTGTTGCCTGGTTGCTCCCCAAAGCCTCCCTTCTCGGAAGACAGCTCTCTCCTAGCTTCCACTAGGCAAGGAGGAACCAT
GGGTGAGATGGCTGGGTGTCACCTGAGCTGACATCAACAGGCCACTGCCACACTGGAGGGGTCAATGGCACCCCCAAAGT
CATGCTGAACTTCTGCTCCAAGTCCAGCAACACCTGCNTCNANGCANCCAACANAGAANCAGAGAGGTGAACCCCTCACT
GGGCCCCTCANGTGANAANAANCANGACAAAGCCCGACAAAGCCGGACAGANCANGAGTATGGTGACNTCNAAGCCNNCT
GCTTTTTNNNNNNNNNATTNNNNACCGANNNCNAGAAANGTGGAAAGGGGTANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es