Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14444C8
Clone ID IST14444C8
Vector VICTR74
Project tigm

Sequence tag IST14444C8HMR1
Sequence
ANNNTANTAAAAGAGGTGACCCCATACCCTGTTCATCCCTCCACTCTAACTCCGCCCAGTTGTCAGTTCTCTGTTGCATA
TGTGTTGCATTGCTGATTACGTCATCCTTACATGTTAGCATCATTGCTTATGCGTTATCTTCATTGCTTCCGTGCCAGCA
TTGCTGCTTATGTGTTANCACTGTTGTTTACNTGTCANCATTGTTGTTACATGTTGGCATCATTGCTTACATCATTGCTT
ATGTGTCAGCATTGCTGCTTACATTGTTGCNACNTGTTANCATCNCTCTTTGCTTATTANCATCATTGCTGCTTATGTGT
TAGTGTN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121258323..121258644 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es