Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12375C9
Clone ID IST12375C9
Vector VICTR76
Project tigm

Sequence tag IST12375C9HMF1
Sequence
ATGCCAGCATTTGAAAAGCAGAGGAAGGCTCTTACAGGATTGAGGCCTACAAAGTGTCTTCAAGACAGTCAGGGATGCTT
ACACTAAGAAACTATGTATGAAAAGAATAAATGTAAGAAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916664..74916785 118
NO GENE  


Sequence tag IST12375C9BBF1
Sequence
CAATGATCTGGCCCAGGCTTAGAACCCTCGAGGGAGTGGCTACAAGCATGGCTCAGTGTAGAGCTCTTTTTTAGTGTGTC
CTGATAGTGATCCCTAACACCTCAATAAAAACCTTTTAATGAGGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGA
CTATTCTTCCTAAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAGCTATCTATAATAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52731893..52732126 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es