Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15066F7
Clone ID IST15066F7
Vector VICTR80
Project tigm

Sequence tag IST15066F7HMR1
Sequence
NATAACTNAGTGCCTCTGGATCCAGCTTCCCCTGAGAAAACGAAGGGAAGGCAAACTGTGATTTCTAAATCTCCTGTTCC
AAAGCGTCCAGTTCTTCCTGCGGTTGGCACTTACGAGATTTGCTGATTTGTTTATTTACTGTGTGTTTGTGTGTGTGAGA
CGGCCGTATGCGCGTGCCACGCTGCACAGGTGGAGGTCAGAGAACTATGTGTGGGAGTCAGTGTTCTCTTTCTACCATCT
GTGTCCTGGAAACGGAACTCAGGACCTTGGGCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87332480..87332752 271
NO GENE  


Sequence tag IST15066F7BBF1
Sequence
CAGTGAATTGGTGGAAAGGGAAGGATTTGAACTCTGTCTCTTGACGCCTTGAGTCAACTCCTAGGCTGTGGCTGAGAGTG
AATCCCTCCCCCACCCCCCCCAGGAGCTCANAGAAATAGGAGTTATATATCTTTTTGCATTTATGGTCTTGAGCTCTTAG
AGGCAAATGATCTAAAGATGGAGTTGGGTGTGTGGCTGAGTGGCTTATGGGGTAAAGGTGCCTGTCTTCAAGTCTGATGA
CCTATGTCGGGTGGAAGGAGAGAATGAACTCCTAGTTATCTTCTGACCTCTGAATACATCATGCACATACTTACTCCCTC
CCATATAAATAAATCAATGTTTAAAAAATGATGGAGGTGGGGCCAGGCTAGCTTANAGGTAGAACACAAN
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87332765..87333153 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


Sequence tag IST15066F7HMF1
Sequence
CAGTGAATTGGTGGAAAGGGAAGGATTTGAACTCTGTCTCTTGACGCCTTGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87332765..87332822 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es