Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0749
Clone ID GC0749
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0749
Sequence
CTTCTTTCTGGTCTTTCTCTGTGCAAGAAGCATGAATCAACTTTGGAGACATGCGGGCCCCTCCACCAACCCGGTACTGA
CTTGCGTGTGCTGGGGTTGGTGAAAGCTGTCTCTGTCACAGGTAAGCATCAGCTGCAGGATCCAAAGCCCTGTGAAAGGG
CATAGCTGGATACAAGTGCGTGGGTAGGTGGCTCCGATAAACCTCTCCTGCGGCGCTACTCCTGTGATGAGGATCAAATG
GGCTGTGACTCACGACGGGATCCACGCCGGGCACTGGAGACTTGGC
Sequence Type mRNA
Unitrap ID UNI290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62152508..62154060 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es