Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10824E6
Clone ID IST10824E6
Vector VICTR76
Project tigm

Sequence tag IST10824E6BBF1
Sequence
GGGTTAATTATTAAATAAAAGCTTTATCTTCTGGCAAACAGGTGCTTTAAGTGATAGAGTGATGCTTGTGGGCGTGGTGC
TTTGTTGATTTGTTTGATGTTTTGTTTTGTTTTGTTTCGTTTTGTGAGACAGCATCTCTCTCTTTAGCCCAAGCCAACCA
GTAACTCACTGTGTAGTTCGGGCTAGTCTCAAATGTGAGGAAGTCCTCCTGCCTCAGCCTGATAAATGCTGAAATTACAA
CATTGCATCATCAGGCTGGGCTGCAGCCCTTTGTGTGGGTCACAATGCTCCCAGCCTTTGTTCTTCTTTCTGCATAGGTC
CCAGATGAGCATTCAGGTTAACTGTGGAAAGTGGCTTCTCGGCTCACTTAANGTGTGATGTCTTCTGTTCTAAAGANTGT
GTGGTCACTTGGTGGGGGTGGCACAGCGCATTGAAGTGGTTTTTCCTANATGAACACAGTGAACATCTTCCTCCCCCCGC
CCCACACTTCCNTCCCTCTCTTCCTTCTCNAGTCTTNANCTTTGTCANANCTGTTATGCNNAACATTTTACNNAGCNNTN

Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114336093..114336648 530
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST10824E6HMF1
Sequence
GGGTTAATTATTAAATAAAAGCTTTATCTTCTGGCAAACAGGTGCTTTAAGTGATAGAGTGATGCTTGTGGGCGTGGTGC
TTTGTTGATTTGTTTGATGTTTTGTTTTGTTTTGTTTCGTTTTGTGAGACAGCATCTCTCTCTTTAGCCCAAGCCAACCA
GTAACTCACTGTGTAGTTCGGGCTAGTCTCAAATGTGAGGAAGTCCTCCTGCCTCANCCTGATAAATGCTGAAATTACAA
CATTGCATCATCAGGCTGGGCTGCANCCCTTTGTGTGGGTCACAATGCTCCCAGCCTTTGTTCTTCTTTCTGCATAGGTC
CCANATGAGCATTCAGGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114336307..114336648 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es